The native tree that is
disappearing into its invader
And a test you can run on a kitchen table
Red mulberry is not mainly being cut down or crowded out. It is being absorbed — hybridised, generation by generation, into the introduced white mulberry that grows alongside it. In four studied populations in southern Ontario, more than half of the trees were already hybrids.1 Many of them look exactly like red mulberry.
This page sets out what is actually known, what the DNA can and cannot settle, and two PCR-and-gel tests — worked out here from 45 published mulberry genomes and 180 published gene sequences — that read the answer off a strip of agarose without sending anything to a sequencing lab. One names the tree's mother. The other, because it reads a gene inherited from both parents, can show a hybrid outright.
Every substantive claim below carries one of these. Computed here means it was calculated directly from public sequence data while writing this page, and can be reproduced from the accessions given. Unverified means I could not confirm it against a source and you should not rely on it.
A tree can go extinct without anything dying
Red mulberry (Morus rubra) is native to eastern North America, from Ontario and Vermont south to Florida and west to Texas and South Dakota. White mulberry (Morus alba) was brought from Asia for silkworm culture and is now one of the commonest weedy trees on the continent.
The two species hybridise readily, and the hybrids are fertile. Where they grow together, pollen moves overwhelmingly in one direction, because there is overwhelmingly more white mulberry pollen. Each generation of backcrossing dilutes the native genome a little further, and the endpoint is not a dead tree — it is a population of trees that still look more or less like red mulberry and are no longer genetically red mulberry.
The measurement everyone cites comes from Burgess, Morgan, Deverno and Husband, published in Molecular Ecology in 2005.1 They genotyped 184 trees from four populations in southern Ontario where both species grow together, using nuclear markers alongside chloroplast sequence.
| Measure | Value |
|---|---|
| Trees that were nuclear hybrids | 53.7% (99 of 184) |
| Pure red mulberry | 29% |
| Pure white mulberry | 18% |
| Range of hybrid frequency across the four sites | 43% – 67% |
| Hybrids with more white than red mulberry markers | 67% |
| Hybrids carrying a white mulberry chloroplast | 68% |
43 polymorphic nuclear markers plus chloroplast sequence. The three-way breakdown is from the underlying thesis.11 Sampling was designed to find red mulberry, so pure white mulberry is under-represented relative to what is actually on the ground.
That last line is the one that shapes everything that follows, and it is worth stating the other way round: 32% of the hybrids carried a red mulberry chloroplast. Hold onto that number. It is the reason no chloroplast test — including the good one below — can ever be the whole answer.
Michigan lists red mulberry as state threatened.2 In Ontario, where the species sits at its northern range edge and hybridisation pressure is worst, most known red mulberry sites have white mulberry growing in them.2
A red mulberry that is genetically half white mulberry will still make fruit, still feed birds, still look like a native tree in a plant survey. The loss is invisible without a test. That is exactly the kind of problem where an amateur with a thermocycler can produce information that does not otherwise exist — because nobody is systematically screening the trees in your county.
What you can actually see from the ground
The two pure species are genuinely distinguishable by eye. The trouble starts with everything in between — so it matters which characters are load-bearing and which are folklore.
| Character | Red mulberry | White mulberry | Worth? |
|---|---|---|---|
| Hairs on the leaf underside | Erect hairs spread evenly over the whole blade — soft to the touch | Confined to the main veins and the tufts in vein axils | Best character |
| Leaf area | Blade 10–18 cm, often much larger | Blade 8–10 cm | Best measurable |
| Upper leaf surface | Roughened, dull green | Glossy, lustrous | Good |
| Marginal teeth | Small, numerous, pointed | Fewer, larger, blunt | Good, underused |
| Leaf apex | Drawn out to a long point | Acute to blunt | Suggestive |
| Bark texture | Flat thin plates peeling outwards | Firm braided ridges, orange showing in the furrows | Suggestive |
| Petiole length | Overlapping; if anything M. alba is longer | Useless | |
| Style length | Both species effectively lack a style | Useless | |
| Male vs female trees | Both subdioecious; ~10% hermaphrodite, and individuals switch between years | Useless | |
| Fruit colour | Both range from white through red to near-black | Useless | |
Compiled from the Flora of North America treatment,8 Nepal, Mayfield & Ferguson 2012,9 and Nepal 2008.10 published
The character to learn is where the hairs sit on the underside — not whether hairs are present. Red mulberry carries erect hairs spread across the whole blade, soft to the touch. White mulberry has them only along the ribs and in the little tufts where veins meet the midrib.
Three things widely believed that are not true
Fruit colour means nothing. Nepal and colleagues put it bluntly: fruit colour is "highly variable within M. alba and non-diagnostic. In fact, in wild populations, fruits of M. alba are usually red to black rather than white."9 The Flora of North America gives white mulberry syncarps as "black, purple, or nearly white."8 More confident misidentification traces to this one piece of folk knowledge than to anything else.
Style length is not diagnostic. This one circulates widely in identification guides. Both species effectively lack a style — Nepal's genus-wide key places M. alba and M. rubra together in the short-or-absent-style half of the genus.10 What older sources call "style length" is a measurement of the stigma arms, and even that is contested.
Whether a tree is male, female or both tells you nothing. Both species are subdioecious, with roughly one tree in ten bearing both sexes, and individuals changing their expression between years.9 Treating breeding system as a species character is precisely the error that produced a spurious mulberry species, M. murrayana, later dismantled by exactly that observation.9
Bark colour is not settled. The Michigan abstract calls red mulberry bark "dark-reddish brown",2 while the Flora of North America, the Canadian status report and Nepal all describe it as grey to greyish-tan and put the orange tint on white mulberry, showing in the furrows between firm ridges and on exposed roots.8129 The reproducible part is the texture — flat peeling plates against firm braided ridges — so use that and ignore the colour. unresolved
One more caution that undercuts almost everything in the table: these characters are read from mature leaves on ordinary shoots. Juvenile growth, stump sprouts and vigorous water shoots converge between the species, and as Nepal puts it, "nearly all of the unique characteristics of M. rubra fail in juvenile leaves."9
Morphology sees species. It cannot see ancestry
Burgess and colleagues measured six morphological characters alongside their genetic markers, and found that the pure and hybrid classes differed on all six.1 That sounds like good news for field identification. It is close to the opposite.
The reason is in which classes the characters separate. Of the six, only leaf area and leaf perimeter told all three groups apart. For the other four — number of lobes, sinus depth, and trichome density on both leaf surfaces — white mulberry and the hybrids were statistically indistinguishable from each other, and both differed from red mulberry.11
This is better news than it sounds for one job and much worse for another. Morphology is a decent tool for finding the trees that are not red mulberry — which is what a removal programme needs. It is close to useless for the question of whether a particular good-looking tree is pure, because the hybrids that most resemble red mulberry are exactly the ones the characters fail on.
Trees that fooled the experts
The sharpest demonstration comes from a Kansas population studied by Nepal, where trees were first assigned by an expert on leaf, bud and bark characters and then genotyped.10 The morphological calls did not survive:
| Marker system | Trees called pure by morphology that were genetically admixed |
|---|---|
| Microsatellites | 10 — nine of them called red mulberry, one white |
| RAPD markers | 9 — five called red mulberry, four white |
Of nine trees that morphology had flagged as possible hybrids, only six were confirmed. And the two marker systems agreed with each other on only 44% of the hybrids they found — a reminder that even the genetic answer depends on which markers you use.10
Conservation practice has already absorbed this. Canada's recovery strategy designates critical habitat for trees "confirmed as pure-strain Red Mulberry trees through genetic testing," and lists confirming the genetic purity of morphologically-identified trees as outstanding work.13 The status report records the consequence plainly: "a few of trees previously counted as Red Mulberry were determined to be hybrids and were excluded from subsequent surveys."12
The one quantitative consolation: of everything measurable on a leaf, hair density on the underside is the best single predictor of what the genome actually says, explaining about 40% of the variation in hybrid index.11 Forty percent is a good morphological character. It is not a test.
The second problem: chloroplasts only remember their mother
Chloroplasts are inherited maternally in the great majority of flowering plants — the chloroplasts in a tree came from the ovule, not the pollen. Burgess and colleagues relied on exactly this when they used mulberry chloroplast DNA to establish which parent was the mother in each hybrid.1 It makes chloroplast DNA a superb species marker and a fundamentally limited hybrid marker.
If a red mulberry flower is pollinated by white mulberry, the seedling is a 50/50 nuclear hybrid carrying a pure red mulberry chloroplast. Every chloroplast test ever devised will call that tree red mulberry, correctly and uselessly. This is not a hypothetical failure mode — it is 32% of the hybrids Burgess found.1
What a chloroplast test is excellent at is the other direction. A tree that looks like red mulberry but returns a white mulberry chloroplast is definitively not pure, and you have found that out for the price of one PCR. In a population where white mulberry is the usual pollen donor and therefore often the maternal parent too, that catches most of the hybrids — just not all.
Closing the remaining gap needs a gene inherited from both parents. That turns out to be possible on the same kitchen table, and it is the second half of the test.
Where the two genomes actually differ
In 2025 a group at South Dakota State University published complete chloroplast genomes for 45 mulberry trees collected across eight US states, deposited as GenBank accessions PQ309062–PQ309106.3 That dataset makes it possible to stop guessing and measure which piece of DNA to look at.
I downloaded all 45 and analysed them directly. computed here
Aligning a red mulberry genome (159,423 bp) against a white mulberry one (159,293 bp) gives 421 single-base differences and 696 separate insertion or deletion events. The largest single indel is 36 bp, and inspecting the ten largest shows most of them to be tandem-repeat expansions — a short motif repeated one extra time. Those expand and contract on their own, are prone to assembly error, and make unreliable species markers.
That rules out the laziest possible test. There is no big clean length difference you could see by running a PCR product straight onto a gel. The dependable signal is in substitutions, and substitutions have to be either sequenced or cut with an enzyme.
Which region carries the signal
For each candidate region I counted positions where all 33 unambiguous red mulberries were fixed for one base and all 10 unambiguous white mulberries fixed for another.
| Region | Fixed differences | of which substitutions | Verdict |
|---|---|---|---|
| rpl32–trnL(UAG) | 131 | 14 | The one to use |
| ycf1 | 93 | 24 | Strong but unwieldy |
| ndhF–rpl32 | 68 | 22 | Strong |
| psbE–petL | 51 | 14 | Good |
| trnS–trnG | 36 | 11 | Usable |
| psbA–trnH | 10 | 2 | Too weak |
| trnL–trnF | 8 | 2 | Too weak |
| rbcL (standard barcode) | 5 | 5 | Works, barely |
| matK (standard barcode) | 4 | 4 | Works, barely |
computed here from GenBank PQ309062–PQ309106.
Two results stand out. First, the standard plant barcodes do work — rbcL and matK carry five and four fixed differences respectively. That is unusual for two species in the same genus, and it means a conventional barcoding workflow is not useless here. But with only four or five informative positions, one sequencing error costs you a quarter of your evidence.
Second, rpl32–trnL(UAG) is in a different league at 131 fixed differences. It separated all 43 unambiguous trees perfectly: every red mulberry scored 131 out of 131 red-type positions, every white mulberry 131 out of 131 white-type. No intermediates, no ambiguity.
The marker that wasn't, and the reference that lied
A perfect 69 bp marker, which does not exist
Early in the analysis a different region looked ideal. The spacer between rps15 and ycf1 came out at 333 bp in every white mulberry and 405–407 bp in every red mulberry — a 70 bp gap, trivially readable on a gel, no enzyme needed.
It is an artifact. The ycf1 gene is annotated as starting 69 bp further along in the white mulberry records than in the red mulberry ones. The same physical DNA therefore falls inside the gene in one set of records and inside the spacer in the other, and comparing "spacer lengths" compares two different things. Searching all 199 Morus chloroplast genomes in GenBank for the supposedly red-mulberry-specific 69 bp block found it present in every single one, including all 101 white mulberries. computed here
Recorded here because it is an easy and completely invisible way to invent a marker. Any length difference derived from annotation coordinates rather than from the sequence itself deserves this check.
The NCBI reference genome for red mulberry is not red mulberry
Scored against the diagnostic positions it comes out 12 white-type to 2 red-type. Its length, 159,289 bp, sits with white mulberry (159,293 bp) and nowhere near the red mulberry range of 159,396–159,423 bp. GenBank records it as identical to accession OP161259.4 The authors of the 2025 study independently noticed that this accession falls among the Asian species in their phylogeny.3 computed here
The practical consequence: anyone who compares a sample against "the M. rubra reference genome" is comparing it against a tree of white mulberry maternal ancestry. Use the vouchered PQ309073–PQ309106 series instead.
The same check turned up the mirror image. Accession PQ309072, deposited as M. alba, carries a 131-out-of-131 pure red mulberry chloroplast — a white-mulberry-identified tree with a red mulberry mother. computed here That is exactly the bidirectional introgression Burgess described, caught in a modern dataset by accident.
GenBank holds 249 nucleotide records for M. rubra against 5,097 for M. alba, computed here and the red mulberry records are not uniformly trustworthy. If you are going to compare your tree against a reference, check the reference first.
One PCR, one enzyme, one gel
The 131 fixed differences in rpl32–trnL(UAG) can be read by sequencing. They can also be read for a few dollars with a restriction enzyme, because some of those differences create or destroy an enzyme's recognition site.
I searched the amplicon for enzymes whose cut count differs consistently between the species, then computed the predicted fragments for all 43 unambiguous trees. One is close to ideal.
HpyCH4III
Every red mulberry carries one cut site in the amplicon. Every white mulberry carries three. computed here The resulting patterns are not subtle size shifts needing careful measurement — they are different pictures.
Read it as a shape rather than a measurement. Red mulberry gives one heavy band high on the gel. White mulberry gives a band slightly below it plus an obvious small band near the bottom. A hybrid with a white mulberry mother gives the white mulberry pattern; a hybrid with a red mulberry mother gives the red mulberry pattern. The test reports the mother, and only the mother.
If HinfI is what you can get
HinfI is cheaper and more widely stocked, and also separates the two, though the pattern is busier. computed here
| Fragments above 60 bp | |
|---|---|
| Red mulberry | 679, 562, 228, 168, 126 |
| White mulberry | 688, 591, 425, 126 |
The diagnostic difference is that red mulberry has bands near 228 and 168 bp where white mulberry has a single band near 425 bp. SspI and BfaI also work if those are what you have.
A second test — and this one is nuclear
Everything above reads the chloroplast, so it reports the mother and nothing else. There is a second locus that does better, and it can be run in the same afternoon on the same DNA.
ITS — the internal transcribed spacer of the ribosomal RNA genes — sits in the nuclear genome, so a tree inherits it from both parents. If the two species carry different ITS variants, a hybrid should carry both at once, and both should be visible on a gel.
I pulled every full-length Morus ITS sequence from GenBank — 90 labelled M. rubra and 90 labelled M. alba — and aligned them. computed here There are 22 near-fixed differences between the species, and one of them creates a restriction site:
The amplicon uses the universal ITS1 and ITS4 primers published by White and colleagues in 1990,16 which are the most widely used primers in plant molecular biology and match Morus directly. verified against the sequences The enzyme is NEB MboI, R0147S, 500 units for $88.00. confirmed
ITS1 TCCGTAGGTGAACCTGCGG
ITS4 TCCTCCGCTTATTGATATGC
It has already worked on a real hybrid
The prediction above would be worth little on its own. But a group at the University of Central Missouri did the experiment in 2010, and the result is sitting in GenBank.
They took a herbarium-vouchered M. alba × M. rubra hybrid — specimen KANU:361918 — cloned its ITS, and sequenced four individual clones from that one tree.17 I downloaded all four and scored them at my diagnostic site. computed here
| Clone from the one hybrid tree | MboI sites | Reads as | Submitters' own annotation |
|---|---|---|---|
| HQ144170 · clone 1 | 2 | white mulberry type | "Morus alba haplotype" |
| HQ144171 · clone 2 | 2 | white mulberry type | "Morus alba haplotype" |
| HQ144175 · clone 3 | 1 | red mulberry type | "Morus rubra haplotype" |
| HQ144187 · clone 4 | 1 | red mulberry type | "Morus rubra haplotype" |
For completeness I scored their pure reference trees too: all eight red mulberry clones carry one MboI site, all three white mulberry clones carry two. computed here The separation is total.
A second nuclear marker, already published
While checking this, I found the locus has independent support. A 2025 paper in Plants genotyped 542 mulberry accessions across the whole ribosomal region and built a marker on a 13 bp insertion in ITS1 that is present in red mulberry and absent in white.18 That insertion creates an FspI site.
I checked it against my own downloaded set and it holds independently of the MboI site: the insertion is present in 88 of 88 clean red mulberry sequences and 1 of 90 white mulberry. computed here So there are two unlinked nuclear markers at the same easy locus, and running both means a hybrid has to fail twice to be missed. That paper also publishes mulberry-specific ITS primers, which are worth preferring over the universal ones if you are ordering fresh.
ITS sits in hundreds of tandem copies, and those copies can be homogenised over generations by concerted evolution — which would erase the hybrid signal. The honest worry was that this makes the test fail on older hybrids.
The evidence says homogenisation in Morus is incomplete. The 2025 survey of 542 accessions concluded that the "widespread occurrences of heterogeneous SNPs and InDels" indicate "incomplete concerted evolution of nrDNA" — cloning recovered 26 distinct ITS sequences from 32 clones of a single tree, and 15 to 26 unique sequences per plant in the others.18 A separate study found polymorphic ITS types in 14 of 33 accessions.19 The hybrid above had not been homogenised at all. No published work reports concerted evolution erasing the red/white distinction.
That is better news than I expected, but it is not a guarantee for a specific tree several generations into backcrossing. Treat a clean result as strong evidence against recent hybridisation rather than proof of purity.
Morus celtidifolia, the Texas or mountain mulberry of the southwestern US and Mexico, shares the red-mulberry-type insertion. computed here Within the eastern range of M. rubra the two do not meaningfully overlap, but in the Southwest this test cannot be assumed to separate them.
The same GenBank check turned up the now-familiar problem: two of the 90 sequences deposited as M. rubra carry pure white mulberry ITS at every diagnostic position. computed here They are OR251260 and FJ605516 — and the independent literature search reached the same two accessions by a different route.
The protocol
- Collect and dry
Young, fully expanded sun leaves. Dry them immediately in silica gel at roughly ten times the tissue mass. This single step matters more than anything else in the workflow — properly dried tissue yields good DNA for years at room temperature, and a leaf left in a warm bag overnight may yield none. Photograph the tree, the bark and both leaf surfaces, and take a GPS point.
- Extract DNA
A silica-column plant kit, or CTAB if you prefer to mix your own. Mulberry leaves are high in polysaccharides and phenolics, so add PVP to a CTAB prep or use a kit with an inhibitor-removal step. A generic animal-tissue kit will disappoint you.
- Amplify rpl32–trnL(UAG)
Published universal primers from Shaw and colleagues.5 I checked both against the actual Morus sequences: computed here
rpL32-F CAGTTCCAAAAAAACGTACTTC
One mismatch to Morus, which reads…CCG…where the primer has…CCA…. It sits at position 8, far from the 3′ end, and will amplify normally.trnL(UAG) CTGCTTCCTAAGAGCAGCGT
Exact match in both species.Expect roughly 1,800 bp. Run 5 µL on a gel to confirm a single clean product before digesting.
- Amplify ITS as well
Same DNA, second tube, primers
ITS1andITS4. Expect roughly 700 bp. Running both loci from one extraction costs one extra tube and doubles what the afternoon tells you. - Digest
Take 10 µL of each product, add buffer and about 5 units of enzyme — HpyCH4III for the chloroplast amplicon, MboI for the ITS amplicon — and hold at 37 °C for an hour. Both enzymes work at the same temperature, so they can share a water bath. No purification step is needed for a diagnostic digest.
- Run and read
1.5% agarose, alongside a 100 bp ladder and — this matters on your first attempts — a known white mulberry as a positive control. White mulberry is everywhere; find one in a hedgerow and use it to prove your assay works before you trust it on anything rare.
Read the two lanes together. The chloroplast lane names the mother's species. The ITS lane says whether both species are represented in the nuclear genome. Three bands in the ITS lane is the result you are looking for and hoping not to find.
The underlying sequence differences are solid — the chloroplast marker holds across 43 independently sequenced genomes with no exceptions, and the ITS marker separates 178 sequences plus a real cloned hybrid correctly. The fragment sizes, however, are predicted computationally, and neither digest has been run on a bench by me. unverified as a bench protocol
The ITS locus is on firmer ground than that phrasing suggests: an equivalent CAPS assay at the same locus is published and was validated on real plants by its authors.18 Still — treat your first few runs as validating the method, not the trees. That is what the white mulberry control is for.
Building the lab on a kitchen table
Everything this test needs was, twenty years ago, a university facility. It is now four appliances and a shoebox of reagents. Nothing below requires a licence, an institution, or an address that looks like a laboratory.
Prices marked confirmed were read off the vendor's own page on 2 August 2026. Everything else is an estimate and should be treated as such.
The four machines
- Thermocycler $695 – $835
The one genuinely non-negotiable instrument: it drives the PCR by cycling temperature precisely. miniPCR bio sells the mini8X at $695 and the mini16X at $835; they sell to individuals and the machines run off a laptop. confirmed15
Used lab equipment is the cheap route — an older Bio-Rad or Eppendorf cycler on eBay or LabX typically goes for a fraction of that. They are heavy, loud, and completely adequate. price unverified
- Gel electrophoresis rig with viewer $309
Separates the cut fragments by size so you can read the pattern. The blueGel at $309 combines the tank, the power supply and a built-in blue-light transilluminator in one unit, which is what makes it worth the money over a bare tank. confirmed15
Buying the cycler and the gel together as the miniPCR DNA Discovery System runs $950–$1,099 and is the single simplest purchase decision here. confirmed
- Something that holds 37 °C $0 – $199
For the enzyme digest. A dedicated incubator such as the Cozy Cube at $199 is tidy confirmed, but a kitchen sous-vide immersion circulator holds 37 °C perfectly well and most households that would attempt this already own one. You also want 65 °C for the DNA extraction, which the same device covers.
- Micropipettes and tips $219
You need to measure 1–20 µL accurately, and nothing in a kitchen does this. Three adjustable pipettes covering roughly 1–10, 20–200 and 100–1000 µL.
The research-grade route is expensive — new Eppendorf, Gilson or Rainin three-packs run $1,130–$1,380. You do not need it. miniPCR's H-style adjustable pipettes are $59 each, so $177 for three, and Edvotek's are $95 each with a lifetime warranty. The tradeoff on the cheap ones is a three-month warranty, not accuracy you would notice here.
Tips: miniPCR is the rare vendor selling genuine single 96-tip racks rather than boxes of 960 — $13, $13 and $16 for the three sizes, $42 the lot. Buying bulk from Bioland costs about $150 for 2,880 tips, which is far more than this project will ever use.
The reagents
- HpyCH4III restriction enzyme $83
The enzyme that does the actual discriminating. NEB catalogue R0618S, 250 units for $83.00, supplied with rCutSmart buffer, recognition site AC^NGT — which is exactly the site the genome analysis identified. At 5 units per digest that is 50 trees. confirmed14
- MboI restriction enzyme $88
The nuclear half of the test — the enzyme that reads ITS and can show a hybrid outright. NEB R0147S, 500 units for $88.00, site GATC, and it runs at 37 °C alongside the other digest. confirmed14 Sau3AI and DpnII cut the same site if that is what you can get.
- HinfI restriction enzyme $77
The alternative, if you would rather have an enzyme you will use for other things. NEB R0155S, 5,000 units for $77.00, site G^ANTC. Far more units for the money, busier band pattern. confirmed
- PCR master mix $53
NEB OneTaq 2X Master Mix, M0482S — $53.00 for 100 reactions. A 2X master mix means you add only water, primers and template, which removes most of the ways a first PCR goes wrong. confirmed
- 100 bp DNA ladder $71
The size reference you read the gel against. NEB N3231S, 100 gel lanes, $71.00. confirmed
- Four primers about $37
Custom-synthesised oligos, ordered by typing in the sequence. Eurofins Genomics publishes $0.42 per base at the 25 nmol desalted scale — about $9.24 for a 22-mer, so roughly $37 for all four. Registration is an ordinary web signup. IDT sells to individuals too but shows no price without an account. One order lasts years. Two pairs: one for the chloroplast locus, one for ITS.
rpL32-F CAGTTCCAAAAAAACGTACTTC
trnL(UAG) CTGCTTCCTAAGAGCAGCGT
ITS1 TCCGTAGGTGAACCTGCGG
ITS4 TCCTCCGCTTATTGATATGCprice unverified
- Plant DNA extraction $22 – $359
Mulberry leaves are loaded with polysaccharides and phenolics that inhibit PCR, so a generic animal-tissue kit will disappoint you. The column kits are the reliable option: Zymo Quick-DNA Plant/Seed, D6020, $273 for 50 preps; Qiagen DNeasy Plant Mini 69104 $326, or DNeasy Plant Pro 69204 $359. confirmed
Much cheaper to start: miniPCR's X-Tract crude-lysate buffer is $22 for 20 extractions. A crude lysate is lower quality than a column prep, but for a robust multi-copy target like chloroplast or ribosomal DNA it is very often enough — and at roughly a dollar a tree it is the sane way to find out whether your protocol works before spending $273. Home-mixed CTAB with added PVP is the other cheap route.
- Gel chemistry $19 – $85
The shortcut worth knowing about: all-in-one agarose tablets that already contain the buffer and the stain — $19 for 8 gels. Drop one in water, microwave, pour. For a first project that removes three separate purchases and the most tedious weighing step.
Buying separately: miniPCR agarose 20 g $46 or GoldBio 100 g $132; TBE buffer powder $7.50 for 600 mL; Biotium GelRed 0.1 mL $34; 6X loading dye $30. confirmed
Use GelRed, GelGreen, SYBR Safe or similar with a blue-light viewer — not ethidium bromide under UV. The modern stains are far less hazardous and blue light will damage neither your eyes nor your DNA.
- 100 bp ladder $49 – $71
Cheaper than the NEB one listed above if you shop: GoldBio ReadyLadder $49 for 500 µL, miniPCR's load-ready version $66. confirmed
- Silica gel desiccant $79 for 55 lb
The cheapest thing per unit on this list and the one that most determines whether any of the rest works. Buy the fine 0.5–1.5 mm non-indicating beads in bulk — a 55 lb drum is $79.20, about $3.18/kg confirmed — plus a small amount of indicating gel as a saturation cue. Avoid the 3–5 mm consumer beads sold for flower drying; drying speed depends on contact area with the leaf, and big beads have little.
A working bench, everything new: about $1,600.
| Line | Choice | Cost |
|---|---|---|
| Thermocycler + gel rig | miniPCR DNA Discovery System | $950 |
| Pipettes + tips | Three miniPCR H-style, one rack each | $219 |
| Both enzymes | HpyCH4III + MboI | $171 |
| PCR master mix | OneTaq, 100 reactions | $53 |
| Four primers | Eurofins, 25 nmol desalted | $37 |
| DNA extraction | X-Tract buffer, 20 preps | $22 |
| Gels | All-in-one agarose tabs, 8 | $19 |
| Ladder | GoldBio ReadyLadder | $49 |
| Silica gel | 55 lb drum | $79 |
| Total | $1,599 |
Swap in a used thermocycler and gel rig and it lands nearer $800. Swap up to a proper column extraction kit and research-grade pipettes and it passes $2,500. The machines are the whole decision; everything else is noise.
Per-tree running cost after setup is a few dollars for both tests. The expensive part is the first tree; the hundredth is nearly free.
Before buying anything
Two cheaper routes are worth considering first.
Community biology labs already own all of this and will let members run their own projects. Verified monthly rates: BosLab, Somerville MA — $50; SoundBio, Seattle — $55, or $135 to lead your own project; ChiTownBio, Chicago — $75; Counter Culture Labs, Oakland — $100; BUGSS, Baltimore — $100; Genspace, Brooklyn — $110 community, $220 for full project access. confirmed Most ask for a short project proposal and a safety session.
Counter Culture Labs is the notable one for this project: it runs a standing plant biology group, and its fungal group already does ITS extraction and sequencing — which is precisely the second assay on this page.
Or skip the equipment entirely. Extract DNA, post it to a sequencing service, and read all 131 chloroplast positions rather than one enzyme's worth. Psomagen charges $3.50 a reaction; Quintara from $4.00; Eurofins SimpleSeq prepaid kits work out at $6.10; Plasmidsaurus sequences an unpurified amplicon for $15 and takes a credit card with no minimum. confirmed Azenta/GENEWIZ confirms in its own FAQ that individuals can register and pay by card, though it publishes no price.
At three to fifteen dollars a read, sequencing twenty trees costs less than the thermocycler. If what you want is the answer rather than the apparatus, that is the honest recommendation.
None of this is dangerous work, but two habits matter: keep the DNA stain off your skin and out of the drain, and never run a sample you care about without a known control alongside it. The most common outcome of a first attempt is not a wrong answer — it is a blank gel, which tells you nothing and costs you a sample.
What this test can never tell you
The two gel tests together catch a great deal: a white mulberry mother, or a nuclear genome still carrying both parental ITS types. What they cannot catch is the tree that is several generations into backcrossing — red mulberry mother, ITS homogenised, and a quarter of its genome still foreign.
How much nuclear data? The general answer comes from a simulation study by Vähä and Primmer,6 whose conclusion is worth quoting: efficient detection of first-generation hybrids needs 12 to 24 markers, but "separating backcrosses from purebred parental individuals requires a considerable genotyping effort (at least 48 loci), even when divergence between parental populations is high."
The arithmetic behind that is simple enough to do on paper. With n markers that are fixed-different between the species, a first-generation hybrid is heterozygous at every one — unmistakable. A backcross is heterozygous at each with probability one half, so its chance of looking pure is 0.5n. A second-generation backcross is heterozygous at about a quarter of them:
| Markers | Chance a first backcross looks pure | Second backcross | Third backcross |
|---|---|---|---|
| 10 | 0.1% | 5.6% | 26% |
| 20 | 0.0001% | 0.3% | 6.9% |
| 50 | negligible | 0.00006% | 0.13% |
Ten markers catch first-generation hybrids and first backcrosses. Fifty make it unlikely that anything within three generations of a hybridisation slips past. Thousands — which is what sequencing gives you — close the question and let you estimate the actual ancestry fraction rather than a yes or no.
The realistic route: genome skimming
Send extracted DNA for low-coverage whole-genome sequencing. At one or two times coverage you recover the complete chloroplast genome as a free byproduct — it is present in thousands of copies per cell — and enough nuclear variants to place the tree on a triangle plot of hybrid index against heterozygosity, which distinguishes first-generation hybrids from backcrosses and from pure trees.7 One experiment, both answers, no marker development.
What it costs, for a real tree, today: Plasmidsaurus publishes $250 for 1 Gb, $500 for 5 Gb, $1,000 for 15 Gb on a eukaryotic genome service that explicitly covers plants. confirmed For a mulberry genome of roughly 340 Mb, 1 Gb of data is about 3× coverage — ample for a hybrid index. They take a credit card, with no minimum order.
That last detail matters more than the price. Novogene, BGI, Azenta and Psomagen all quote-gate this service, and their published rate cards assume you deliver a finished sequencing library — which you cannot make without a lab. their actual per-sample prices could not be verified Plasmidsaurus is, as far as I can establish, the only route by which a private individual buys a plant genome outright.
One complication: there is no red mulberry nuclear genome assembly. NCBI lists zero assemblies and six sequencing runs for the species, against four assemblies for white mulberry. computed here Nuclear reads therefore have to be mapped to the white mulberry reference, which is workable for ancestry estimation but introduces a mild bias and needs someone who knows what they are doing.
Which is a reasonable place to end up. A test that costs a few dollars and rules out most of the problem is worth having, and it is the difference between a shortlist and a guess. Send the survivors for sequencing.
What to do with a result
Voucher everything. A genetic result attached to a GPS point, a photograph set and a pressed specimen is evidence; the same result attached to a memory is an anecdote. Herbarium sheets can be deposited with a regional herbarium, and most are glad of material from a documented wild population.
Consider sending samples onward. Madhav Nepal's group at South Dakota State University generated the 45-genome dataset this page is built on, works directly on red mulberry hybridisation,3 and has just published a population-genetic survey of 78 red mulberries across Kansas, Iowa, Wisconsin and Nebraska.20 Their sampling is concentrated in the central US; the eastern and southeastern parts of the range look thin. Contributing tissue from an uncovered population is a real contribution rather than a favour asked.
And if a genuinely pure population turns up, that is worth telling your state natural heritage program about, whether or not red mulberry is formally listed where you are.
References
- Burgess, K. S., Morgan, M., Deverno, L. & Husband, B. C. (2005). Asymmetrical introgression between two Morus species (M. alba, M. rubra) that differ in abundance. Molecular Ecology 14: 3471–3483. pubmed.ncbi.nlm.nih.gov/16156816
- Penskar, M. R. (2009). Special Plant Abstract for Morus rubra (red mulberry). Michigan Natural Features Inventory, Lansing, MI. mnfi.anr.msu.edu
- Adhikari, B., Parajuli, S. & Nepal, M. P. (2025). Reporting complete chloroplast genome of endangered red mulberry, useful for understanding hybridization and phylogenetic relationships. Scientific Reports. GenBank PQ309062–PQ309106. pmc.ncbi.nlm.nih.gov/articles/PMC12008415
- Zeng, Q., Chen, M., Wang, S., Xu, X., Li, T., Xiang, Z. & He, N. (2022). Comparative and phylogenetic analyses of the chloroplast genome. Frontiers in Plant Science 13: 1047592. Source of accession OP161259, from which RefSeq NC_070233 is derived. ncbi.nlm.nih.gov/nuccore/NC_070233
- Shaw, J., Lickey, E. B., Schilling, E. E. & Small, R. L. (2007). Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany 94: 275–288. Source of the rpL32-F and trnL(UAG) primers. doi.org/10.3732/ajb.94.3.275
- Vähä, J.-P. & Primmer, C. R. (2006). Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Molecular Ecology 15: 63–72. pubmed.ncbi.nlm.nih.gov/16367830
- Wiens, B. J. & Colella, J. P. (2025). triangulaR: an R package for identifying AIMs and building triangle plots using SNP data from hybrid zones. Heredity. nature.com/articles/s41437-025-00760-2
- Wunderlin, R. P. (1997). Moraceae: Morus. In Flora of North America North of Mexico, vol. 3. Oxford University Press. efloras.org — genus key, M. rubra, M. alba
- Nepal, M. P., Mayfield, M. H. & Ferguson, C. J. (2012). Identification of eastern North American Morus: taxonomic status of M. murrayana. Phytoneuron 2012-26: 1–6. The clearest published character comparison, and the source of the statement that fruit colour is non-diagnostic. phytoneuron.net (PDF)
- Nepal, M. P. (2008). Systematics and reproductive biology of the genus Morus L. (Moraceae). PhD dissertation, Kansas State University. Source of the Konza Prairie morphology-versus-genotype comparison. krex.k-state.edu
- Burgess, K. S. (2004). The genetic and demographic consequences of hybridization in small plant populations. PhD thesis, University of Guelph. The full analysis underlying Burgess et al. 2005, including the six-character morphometrics. atrium.lib.uoguelph.ca
- COSEWIC (2014). Assessment and Status Report on the Red Mulberry Morus rubra in Canada. Listed under COSEWIC assessments on the species page. Species at Risk Public Registry — Red Mulberry
- Parks Canada Agency (2013). Recovery Strategy for the Red Mulberry (Morus rubra) in Canada. Species at Risk Act Recovery Strategy Series. Listed under Recovery strategies on the same species page. Species at Risk Public Registry — Red Mulberry
- New England Biolabs product catalogue, prices confirmed 2 August 2026: HpyCH4III R0618S, HinfI R0155S, OneTaq 2X Master Mix M0482S, 100 bp DNA Ladder N3231S
- miniPCR bio (Amplyus LLC) store, prices confirmed 2 August 2026. minipcr.com/store
- White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications, pp. 315–322. Academic Press. The source of the ITS1 and ITS4 primers, now used across plants as well as fungi. doi.org/10.1016/B978-0-12-372180-8.50042-1
- Nikaido, S., Salah, S. M., Ely, J. S., Wolf, H. J. & Raveill, J. A. (2010). Mulberry (Morus: Moraceae) hybridization in eastern North America: morphological and molecular evidence. University of Central Missouri. Unpublished; data deposited as GenBank HQ144170–HQ144187, including four cloned ITS sequences from the vouchered hybrid KANU:361918. ncbi.nlm.nih.gov/nuccore/HQ144170
- Xu, X., Zhang, L., Bi, C., Qin, M., Wang, S., Li, D., He, N. & Zeng, Q. (2025). Extensive nrDNA polymorphism in Morus L. and its application. Plants 14(16): 2570. Open access. Source of the 13 bp ITS1 indel marker, the FspI/BstEII CAPS assay, and the evidence that concerted evolution in Morus is incomplete. doi.org/10.3390/plants14162570
- Xuan, Y., Wu, Y., Li, P., Liu, R., Luo, Y., Yuan, J., Xiang, Z. & He, N. (2019). Molecular phylogeny of mulberries reconstructed from ITS and two cpDNA sequences. PeerJ 7: e8158. doi.org/10.7717/peerj.8158
- Schreier, S. J. & Nepal, M. P. (2026). Population genetics of native red mulberry at its northwestern boundary suggests postglacial founder effects. bioRxiv preprint, posted 14 July 2026. 78 M. rubra individuals across six populations in Kansas, Iowa, Wisconsin and Nebraska. doi.org/10.64898/2026.07.11.737963