The native tree that is
disappearing into its invader

A tree can go extinct without anything dying

Red mulberry (Morus rubra) is native to eastern North America, from Ontario and Vermont south to Florida and west to Texas and South Dakota. White mulberry (Morus alba) was brought from Asia for silkworm culture and is now one of the commonest weedy trees on the continent.

The two species hybridise readily, and the hybrids are fertile. Where they grow together, pollen moves overwhelmingly in one direction, because there is overwhelmingly more white mulberry pollen. Each generation of backcrossing dilutes the native genome a little further, and the endpoint is not a dead tree — it is a population of trees that still look more or less like red mulberry and are no longer genetically red mulberry.

The measurement everyone cites comes from Burgess, Morgan, Deverno and Husband, published in Molecular Ecology in 2005.1 They genotyped 184 trees from four populations in southern Ontario where both species grow together, using nuclear markers alongside chloroplast sequence.

That last line is the one that shapes everything that follows, and it is worth stating the other way round: 32% of the hybrids carried a red mulberry chloroplast. Hold onto that number. It is the reason no chloroplast test — including the good one below — can ever be the whole answer.

Michigan lists red mulberry as state threatened.2 In Ontario, where the species sits at its northern range edge and hybridisation pressure is worst, most known red mulberry sites have white mulberry growing in them.2

What you can actually see from the ground

The two pure species are genuinely distinguishable by eye. The trouble starts with everything in between — so it matters which characters are load-bearing and which are folklore.

The character to learn is where the hairs sit on the underside — not whether hairs are present. Red mulberry carries erect hairs spread across the whole blade, soft to the touch. White mulberry has them only along the ribs and in the little tufts where veins meet the midrib.

Three things widely believed that are not true

Fruit colour means nothing. Nepal and colleagues put it bluntly: fruit colour is "highly variable within M. alba and non-diagnostic. In fact, in wild populations, fruits of M. alba are usually red to black rather than white."9 The Flora of North America gives white mulberry syncarps as "black, purple, or nearly white."8 More confident misidentification traces to this one piece of folk knowledge than to anything else.

Style length is not diagnostic. This one circulates widely in identification guides. Both species effectively lack a style — Nepal's genus-wide key places M. alba and M. rubra together in the short-or-absent-style half of the genus.10 What older sources call "style length" is a measurement of the stigma arms, and even that is contested.

Whether a tree is male, female or both tells you nothing. Both species are subdioecious, with roughly one tree in ten bearing both sexes, and individuals changing their expression between years.9 Treating breeding system as a species character is precisely the error that produced a spurious mulberry species, M. murrayana, later dismantled by exactly that observation.9

One more caution that undercuts almost everything in the table: these characters are read from mature leaves on ordinary shoots. Juvenile growth, stump sprouts and vigorous water shoots converge between the species, and as Nepal puts it, "nearly all of the unique characteristics of M. rubra fail in juvenile leaves."9

Morphology sees species. It cannot see ancestry

Burgess and colleagues measured six morphological characters alongside their genetic markers, and found that the pure and hybrid classes differed on all six.1 That sounds like good news for field identification. It is close to the opposite.

The reason is in which classes the characters separate. Of the six, only leaf area and leaf perimeter told all three groups apart. For the other four — number of lobes, sinus depth, and trichome density on both leaf surfaces — white mulberry and the hybrids were statistically indistinguishable from each other, and both differed from red mulberry.11

This is better news than it sounds for one job and much worse for another. Morphology is a decent tool for finding the trees that are not red mulberry — which is what a removal programme needs. It is close to useless for the question of whether a particular good-looking tree is pure, because the hybrids that most resemble red mulberry are exactly the ones the characters fail on.

Trees that fooled the experts

The sharpest demonstration comes from a Kansas population studied by Nepal, where trees were first assigned by an expert on leaf, bud and bark characters and then genotyped.10 The morphological calls did not survive:

Of nine trees that morphology had flagged as possible hybrids, only six were confirmed. And the two marker systems agreed with each other on only 44% of the hybrids they found — a reminder that even the genetic answer depends on which markers you use.10

Conservation practice has already absorbed this. Canada's recovery strategy designates critical habitat for trees "confirmed as pure-strain Red Mulberry trees through genetic testing," and lists confirming the genetic purity of morphologically-identified trees as outstanding work.13 The status report records the consequence plainly: "a few of trees previously counted as Red Mulberry were determined to be hybrids and were excluded from subsequent surveys."12

The one quantitative consolation: of everything measurable on a leaf, hair density on the underside is the best single predictor of what the genome actually says, explaining about 40% of the variation in hybrid index.11 Forty percent is a good morphological character. It is not a test.

The second problem: chloroplasts only remember their mother

Chloroplasts are inherited maternally in the great majority of flowering plants — the chloroplasts in a tree came from the ovule, not the pollen. Burgess and colleagues relied on exactly this when they used mulberry chloroplast DNA to establish which parent was the mother in each hybrid.1 It makes chloroplast DNA a superb species marker and a fundamentally limited hybrid marker.

If a red mulberry flower is pollinated by white mulberry, the seedling is a 50/50 nuclear hybrid carrying a pure red mulberry chloroplast. Every chloroplast test ever devised will call that tree red mulberry, correctly and uselessly. This is not a hypothetical failure mode — it is 32% of the hybrids Burgess found.1

What a chloroplast test is excellent at is the other direction. A tree that looks like red mulberry but returns a white mulberry chloroplast is definitively not pure, and you have found that out for the price of one PCR. In a population where white mulberry is the usual pollen donor and therefore often the maternal parent too, that catches most of the hybrids — just not all.

Where the two genomes actually differ

In 2025 a group at South Dakota State University published complete chloroplast genomes for 45 mulberry trees collected across eight US states, deposited as GenBank accessions PQ309062–PQ309106.3 That dataset makes it possible to stop guessing and measure which piece of DNA to look at.

I downloaded all 45 and analysed them directly. computed here

Aligning a red mulberry genome (159,423 bp) against a white mulberry one (159,293 bp) gives 421 single-base differences and 696 separate insertion or deletion events. The largest single indel is 36 bp, and inspecting the ten largest shows most of them to be tandem-repeat expansions — a short motif repeated one extra time. Those expand and contract on their own, are prone to assembly error, and make unreliable species markers.

That rules out the laziest possible test. There is no big clean length difference you could see by running a PCR product straight onto a gel. The dependable signal is in substitutions, and substitutions have to be either sequenced or cut with an enzyme.

Which region carries the signal

For each candidate region I counted positions where all 33 unambiguous red mulberries were fixed for one base and all 10 unambiguous white mulberries fixed for another.

Two results stand out. First, the standard plant barcodes do work — rbcL and matK carry five and four fixed differences respectively. That is unusual for two species in the same genus, and it means a conventional barcoding workflow is not useless here. But with only four or five informative positions, one sequencing error costs you a quarter of your evidence.

Second, rpl32–trnL(UAG) is in a different league at 131 fixed differences. It separated all 43 unambiguous trees perfectly: every red mulberry scored 131 out of 131 red-type positions, every white mulberry 131 out of 131 white-type. No intermediates, no ambiguity.

The marker that wasn't, and the reference that lied

A perfect 69 bp marker, which does not exist

Early in the analysis a different region looked ideal. The spacer between rps15 and ycf1 came out at 333 bp in every white mulberry and 405–407 bp in every red mulberry — a 70 bp gap, trivially readable on a gel, no enzyme needed.

It is an artifact. The ycf1 gene is annotated as starting 69 bp further along in the white mulberry records than in the red mulberry ones. The same physical DNA therefore falls inside the gene in one set of records and inside the spacer in the other, and comparing "spacer lengths" compares two different things. Searching all 199 Morus chloroplast genomes in GenBank for the supposedly red-mulberry-specific 69 bp block found it present in every single one, including all 101 white mulberries. computed here

Recorded here because it is an easy and completely invisible way to invent a marker. Any length difference derived from annotation coordinates rather than from the sequence itself deserves this check.

The NCBI reference genome for red mulberry is not red mulberry

Scored against the diagnostic positions it comes out 12 white-type to 2 red-type. Its length, 159,289 bp, sits with white mulberry (159,293 bp) and nowhere near the red mulberry range of 159,396–159,423 bp. GenBank records it as identical to accession OP161259.4 The authors of the 2025 study independently noticed that this accession falls among the Asian species in their phylogeny.3 computed here

The practical consequence: anyone who compares a sample against "the M. rubra reference genome" is comparing it against a tree of white mulberry maternal ancestry. Use the vouchered PQ309073–PQ309106 series instead.

The same check turned up the mirror image. Accession PQ309072, deposited as M. alba, carries a 131-out-of-131 pure red mulberry chloroplast — a white-mulberry-identified tree with a red mulberry mother. computed here That is exactly the bidirectional introgression Burgess described, caught in a modern dataset by accident.

One PCR, one enzyme, one gel

The 131 fixed differences in rpl32–trnL(UAG) can be read by sequencing. They can also be read for a few dollars with a restriction enzyme, because some of those differences create or destroy an enzyme's recognition site.

I searched the amplicon for enzymes whose cut count differs consistently between the species, then computed the predicted fragments for all 43 unambiguous trees. One is close to ideal.

HpyCH4III

Every red mulberry carries one cut site in the amplicon. Every white mulberry carries three. computed here The resulting patterns are not subtle size shifts needing careful measurement — they are different pictures.

Read it as a shape rather than a measurement. Red mulberry gives one heavy band high on the gel. White mulberry gives a band slightly below it plus an obvious small band near the bottom. A hybrid with a white mulberry mother gives the white mulberry pattern; a hybrid with a red mulberry mother gives the red mulberry pattern. The test reports the mother, and only the mother.

If HinfI is what you can get

HinfI is cheaper and more widely stocked, and also separates the two, though the pattern is busier. computed here

The diagnostic difference is that red mulberry has bands near 228 and 168 bp where white mulberry has a single band near 425 bp. SspI and BfaI also work if those are what you have.

The protocol

1. Collect and dry

   Young, fully expanded sun leaves. Dry them immediately in silica gel at roughly ten times the tissue mass. This single step matters more than anything else in the workflow — properly dried tissue yields good DNA for years at room temperature, and a leaf left in a warm bag overnight may yield none. Photograph the tree, the bark and both leaf surfaces, and take a GPS point.

2. Extract DNA

   A silica-column plant kit, or CTAB if you prefer to mix your own. Mulberry leaves are high in polysaccharides and phenolics, so add PVP to a CTAB prep or use a kit with an inhibitor-removal step. A generic animal-tissue kit will disappoint you.

3. Amplify rpl32–trnL(UAG)

   Published universal primers from Shaw and colleagues.5 I checked both against the actual Morus sequences: computed here

   rpL32-F  CAGTTCCAAAAAAACGTACTTC
   One mismatch to Morus, which reads …CCG… where the primer has …CCA…. It sits at position 8, far from the 3′ end, and will amplify normally.

   trnL(UAG)  CTGCTTCCTAAGAGCAGCGT
   Exact match in both species.

   Expect roughly 1,800 bp. Run 5 µL on a gel to confirm a single clean product before digesting.

4. Digest

   Take 10 µL of PCR product, add buffer and 5 units of HpyCH4III, and hold at 37 °C for an hour. No purification step is needed for a diagnostic digest.

5. Run and read

   1.5% agarose, alongside a 100 bp ladder and — this matters on your first attempts — a known white mulberry as a positive control. White mulberry is everywhere; find one in a hedgerow and use it to prove your assay works before you trust it on anything rare.

Building the lab on a kitchen table

Everything this test needs was, twenty years ago, a university facility. It is now four appliances and a shoebox of reagents. Nothing below requires a licence, an institution, or an address that looks like a laboratory.

Prices marked confirmed were read off the vendor's own page on 2 August 2026. Everything else is an estimate and should be treated as such.

The four machines

• Thermocycler $695 – $835

  The one genuinely non-negotiable instrument: it drives the PCR by cycling temperature precisely. miniPCR bio sells the mini8X at $695 and the mini16X at $835; they sell to individuals and the machines run off a laptop. confirmed15

  Used lab equipment is the cheap route — an older Bio-Rad or Eppendorf cycler on eBay or LabX typically goes for a fraction of that. They are heavy, loud, and completely adequate. price unverified

• Gel electrophoresis rig with viewer $309

  Separates the cut fragments by size so you can read the pattern. The blueGel at $309 combines the tank, the power supply and a built-in blue-light transilluminator in one unit, which is what makes it worth the money over a bare tank. confirmed15

  Buying the cycler and the gel together as the miniPCR DNA Discovery System runs $950–$1,099 and is the single simplest purchase decision here. confirmed

• Something that holds 37 °C $0 – $199

  For the enzyme digest. A dedicated incubator such as the Cozy Cube at $199 is tidy confirmed, but a kitchen sous-vide immersion circulator holds 37 °C perfectly well and most households that would attempt this already own one. You also want 65 °C for the DNA extraction, which the same device covers.

• Micropipettes and tips est. $150 – $300

  You need to measure 1–20 µL accurately; nothing in a kitchen does this. A set covering roughly 0.5–10 µL, 10–100 µL and 100–1000 µL, plus racked tips. Serviceable off-brand sets are widely sold; miniPCR and Home Science Tools both stock them. price unverified

The reagents

• HpyCH4III restriction enzyme $83

  The enzyme that does the actual discriminating. NEB catalogue R0618S, 250 units for $83.00, supplied with rCutSmart buffer, recognition site AC^NGT — which is exactly the site the genome analysis identified. At 5 units per digest that is 50 trees. confirmed14

• HinfI restriction enzyme $77

  The alternative, if you would rather have an enzyme you will use for other things. NEB R0155S, 5,000 units for $77.00, site G^ANTC. Far more units for the money, busier band pattern. confirmed

• PCR master mix $53

  NEB OneTaq 2X Master Mix, M0482S — $53.00 for 100 reactions. A 2X master mix means you add only water, primers and template, which removes most of the ways a first PCR goes wrong. confirmed

• 100 bp DNA ladder $71

  The size reference you read the gel against. NEB N3231S, 100 gel lanes, $71.00. confirmed

• The two primers est. $10 – $25 total

  Custom-synthesised oligos, ordered by typing in the sequence. IDT and Eurofins Genomics both sell to individuals. A 25 nmol desalted oligo is the cheapest option and is ample — one order lasts years.

  rpL32-F   CAGTTCCAAAAAAACGTACTTC
  trnL(UAG)  CTGCTTCCTAAGAGCAGCGT

  price unverified

• Plant DNA extraction kit est. $100 – $200

  Mulberry leaves are loaded with polysaccharides and phenolics that inhibit PCR, so this is not the place to improvise with a generic kit. Ask for a plant-specific column kit — Qiagen DNeasy Plant Pro or Zymo Quick-DNA Plant/Seed are the standards. A home-mixed CTAB buffer with PVP added works too and costs almost nothing, at the price of an afternoon and a fume-free workspace. price unverified

• Agarose, buffer, loading dye, safe stain est. $60 – $120

  Agarose powder, TAE or TBE buffer, 6X loading dye, and a DNA stain. Use GelRed, SYBR Safe or a similar modern stain and a blue-light viewer — not ethidium bromide under UV. The modern stains are dramatically less hazardous and blue light will not damage your eyes or your sample. Carolina Biological and Home Science Tools sell all of it to private buyers. price unverified

• Silica gel desiccant est. $15 – $30

  The cheapest item on the list and the one that most determines whether any of the rest works. Indicating silica gel beads, bought by the kilogram, from any craft or food-storage supplier.

Before buying anything

Two cheaper routes are worth considering first. Community biology labs — Genspace in New York, BioCurious in the Bay Area, Counter Culture Labs in Oakland, and a scattering of others — have all of this equipment and membership costs far less than buying it. If one is within reach, use it for the first attempts and buy hardware only if the project outlives the novelty.

And if the goal is an answer rather than a hobby, skip the gel entirely: extract DNA, send it to a service, and let them sequence it. That gives you all 131 diagnostic positions instead of one enzyme's worth, and it needs no equipment beyond a way to grind a leaf.

What this test can never tell you

A red mulberry result means the tree had a red mulberry mother. It does not mean the tree is pure. Settling that requires nuclear DNA, because only nuclear DNA carries both parents.

How much nuclear data? The general answer comes from a simulation study by Vähä and Primmer,6 whose conclusion is worth quoting: efficient detection of first-generation hybrids needs 12 to 24 markers, but "separating backcrosses from purebred parental individuals requires a considerable genotyping effort (at least 48 loci), even when divergence between parental populations is high."

The arithmetic behind that is simple enough to do on paper. With n markers that are fixed-different between the species, a first-generation hybrid is heterozygous at every one — unmistakable. A backcross is heterozygous at each with probability one half, so its chance of looking pure is 0.5ⁿ. A second-generation backcross is heterozygous at about a quarter of them:

Ten markers catch first-generation hybrids and first backcrosses. Fifty make it unlikely that anything within three generations of a hybridisation slips past. Thousands — which is what sequencing gives you — close the question and let you estimate the actual ancestry fraction rather than a yes or no.

The realistic route: genome skimming

Send leaf tissue or extracted DNA for low-coverage whole-genome sequencing. At one or two times coverage you recover the complete chloroplast genome as a free byproduct — it is present in thousands of copies per cell — and enough nuclear variants to place the tree on a triangle plot of hybrid index against heterozygosity, which distinguishes first-generation hybrids from backcrosses and from pure trees.7 One experiment, both answers, no marker development.

One complication: there is no red mulberry nuclear genome assembly. NCBI lists zero assemblies and six sequencing runs for the species, against four assemblies for white mulberry. computed here Nuclear reads therefore have to be mapped to the white mulberry reference, which is workable for ancestry estimation but introduces a mild bias and needs someone who knows what they are doing.

What to do with a result

Voucher everything. A genetic result attached to a GPS point, a photograph set and a pressed specimen is evidence; the same result attached to a memory is an anecdote. Herbarium sheets can be deposited with a regional herbarium, and most are glad of material from a documented wild population.

Consider sending samples onward. Madhav Nepal's group at South Dakota State University generated the 45-genome dataset this page is built on and works directly on red mulberry hybridisation.3 Their sampling covers eight central US states; the eastern and southeastern parts of the range look thin. Contributing tissue from an uncovered population is a real contribution rather than a favour asked.

And if a genuinely pure population turns up, that is worth telling your state natural heritage program about, whether or not red mulberry is formally listed where you are.

References

1. Burgess, K. S., Morgan, M., Deverno, L. & Husband, B. C. (2005). Asymmetrical introgression between two Morus species (M. alba, M. rubra) that differ in abundance. Molecular Ecology 14: 3471–3483. pubmed.ncbi.nlm.nih.gov/16156816
2. Penskar, M. R. (2009). Special Plant Abstract for Morus rubra (red mulberry). Michigan Natural Features Inventory, Lansing, MI. mnfi.anr.msu.edu
3. Adhikari, B., Parajuli, S. & Nepal, M. P. (2025). Reporting complete chloroplast genome of endangered red mulberry, useful for understanding hybridization and phylogenetic relationships. Scientific Reports. GenBank PQ309062–PQ309106. pmc.ncbi.nlm.nih.gov/articles/PMC12008415
4. Zeng, Q., Chen, M., Wang, S., Xu, X., Li, T., Xiang, Z. & He, N. (2022). Comparative and phylogenetic analyses of the chloroplast genome. Frontiers in Plant Science 13: 1047592. Source of accession OP161259, from which RefSeq NC_070233 is derived. ncbi.nlm.nih.gov/nuccore/NC_070233
5. Shaw, J., Lickey, E. B., Schilling, E. E. & Small, R. L. (2007). Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany 94: 275–288. Source of the rpL32-F and trnL(UAG) primers. doi.org/10.3732/ajb.94.3.275
6. Vähä, J.-P. & Primmer, C. R. (2006). Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Molecular Ecology 15: 63–72. pubmed.ncbi.nlm.nih.gov/16367830
7. Wiens, B. J. & Colella, J. P. (2025). triangulaR: an R package for identifying AIMs and building triangle plots using SNP data from hybrid zones. Heredity. nature.com/articles/s41437-025-00760-2
8. Wunderlin, R. P. (1997). Moraceae: Morus. In Flora of North America North of Mexico, vol. 3. Oxford University Press. efloras.org — genus key, M. rubra, M. alba
9. Nepal, M. P., Mayfield, M. H. & Ferguson, C. J. (2012). Identification of eastern North American Morus: taxonomic status of M. murrayana. Phytoneuron 2012-26: 1–6. The clearest published character comparison, and the source of the statement that fruit colour is non-diagnostic. phytoneuron.net (PDF)
10. Nepal, M. P. (2008). Systematics and reproductive biology of the genus Morus L. (Moraceae). PhD dissertation, Kansas State University. Source of the Konza Prairie morphology-versus-genotype comparison. krex.k-state.edu
11. Burgess, K. S. (2004). The genetic and demographic consequences of hybridization in small plant populations. PhD thesis, University of Guelph. The full analysis underlying Burgess et al. 2005, including the six-character morphometrics. atrium.lib.uoguelph.ca
12. COSEWIC (2014). Assessment and Status Report on the Red Mulberry Morus rubra in Canada. species-registry.canada.ca (PDF)
13. Parks Canada Agency (2013). Recovery Strategy for the Red Mulberry (Morus rubra) in Canada. Species at Risk Act Recovery Strategy Series. species-registry.canada.ca (PDF)
14. New England Biolabs product catalogue, prices confirmed 2 August 2026: HpyCH4III R0618S, HinfI R0155S, OneTaq 2X Master Mix M0482S, 100 bp DNA Ladder N3231S
15. miniPCR bio (Amplyus LLC) store, prices confirmed 2 August 2026. minipcr.com/store