The-Files

Southern OntarioFour populations · 184 trees · 2005

A tree can go extinct without anything dying

Red mulberry (Morus rubra) is native to eastern North America, from Ontario and Vermont south to Florida and west to Texas and South Dakota. White mulberry (Morus alba) was brought from Asia for silkworm culture and is now one of the commonest weedy trees on the continent.

The two species hybridise readily, and the hybrids are fertile. Where they grow together, the hybrids carry more white mulberry ancestry than red, and the bias is stronger where white mulberry is more common. Each generation of backcrossing dilutes the native genome further. No tree dies; the end state is a stand whose red mulberry ancestry survives only as fragments in genomes that are increasingly white mulberry.

The measurement everyone cites comes from Burgess, Morgan, Deverno and Husband, published in Molecular Ecology in 2005.1 They genotyped 184 trees from four populations in southern Ontario where both species grow together, using nuclear markers alongside chloroplast sequence.

The last line matters most for what follows. Put the other way round, 32% of those hybrids carried a red mulberry chloroplast. That is why no chloroplast test, including the one derived below, can be enough on its own.

Michigan lists red mulberry as state threatened.2 In Ontario, where the species sits at its northern range edge and hybridisation pressure is worst, most known red mulberry sites have white mulberry growing in them.2

The rest of this page asks which test to use, and what it will settle. The options are more limited than they first appear, so it is worth understanding them before you spend anything.

Eastern North AmericaMature leaves, ordinary shoots

What you can actually see from the ground

The two pure species can be told apart by eye. Hybrids are the problem, so it matters which characters separate the species and which are folklore.

The character to learn is where the hairs sit on the underside, not whether there are hairs. Red mulberry carries erect hairs spread across the whole blade, soft to the touch. White mulberry has them only along the ribs and in the little tufts where veins meet the midrib.

Three things widely believed that are not true

Fruit colour means nothing. Nepal and colleagues put it bluntly: fruit colour is "highly variable within M. alba and non-diagnostic. In fact, in wild populations, fruits of M. alba are usually red to black rather than white."9 The Flora of North America gives white mulberry syncarps as "black, purple, or nearly white."8 This belief causes more confident misidentifications than any other.

Style length is not diagnostic. This one circulates widely in identification guides. Both species have a very short style or none (under 1 mm in Nepal's treatment), so style length does not separate them. His genus-wide key places M. alba and M. rubra together in the short-or-absent-style half of the genus.10 What older sources call "style length" is a measurement of the stigma arms, and even that is contested.

Whether a tree is male, female or both is not a reliable species character. Both species are subdioecious, with roughly one tree in ten bearing both sexes,9 and a similar fraction switching sex from one year to the next.10 Treating breeding system as a species character produced a spurious mulberry species, M. murrayana, which was later dismissed on the same observation.9

One more caution applies to almost everything in the table: these characters are read from mature leaves on ordinary shoots. Juvenile growth, stump sprouts and vigorous water shoots converge between the species, and as Nepal puts it, "nearly all of the unique characteristics of M. rubra fail in juvenile leaves."9

Konza Prairie, KansasField calls against markers · 2008

Morphology sees species. It barely sees ancestry

Burgess and colleagues measured six morphological characters alongside their genetic markers, and the pure and hybrid classes differed on all six.1 That result is less useful for field identification than it sounds.

The problem is which classes the characters separate. Only leaf area and leaf perimeter told all three groups apart. On the other four (number of lobes, sinus depth, and trichome density on both leaf surfaces), white mulberry and the hybrids were statistically indistinguishable from each other, and both differed from red mulberry.1

That helps one job and hurts another. Morphology is a decent way to find trees that are not red mulberry, which is what a removal programme needs. It does little to show that a good-looking tree is pure, because the hybrids that most resemble red mulberry are the ones the characters fail on.

Field calls and marker panels did not line up

The clearest example comes from a Kansas population studied by Nepal.10 Trees were assigned in the field to red mulberry, white mulberry or possible hybrid on leaf, bud and bark characters. Subsets were then run through a 49-band RAPD analysis and three microsatellite loci. Neither marker set agreed with the field calls, or with each other.

These are candidate hybrids, not confirmed ones. The study had no validated pure-parent panel and no known crosses. The intermediate-ancestry range was also set from the average scores of the morphologically assigned parental trees, so morphology helped define the yardstick it was checked against. The result shows that field morphology and two small marker panels gave substantially different answers. It does not measure how often morphology was wrong.10

Conservation practice already reflects this. Canada's recovery strategy designates critical habitat for trees "confirmed as pure-strain Red Mulberry trees through genetic testing," and lists confirming the genetic purity of morphologically-identified trees as outstanding work.13 The status report records the consequence: "a few of trees previously counted as Red Mulberry were determined to be hybrids and were excluded from subsequent surveys."12

Of everything measurable on a leaf, hair density on the underside is the best single predictor of a tree's genetic ancestry. On its own it explains about 30% of the variation in hybrid index. In a combined regression of the four characters that individually tracked hybrid index, it was the only one that stayed significant, and the model reached 40%.1 That makes it a good morphological character, but not a test.

Settling the question takes a molecular test, and the next file covers what decides which one.

On paperInheritance and backcross arithmetic

Two things decide what a test can possibly see

Price and convenience matter less than two facts about a marker: how it is inherited, and how many generations of backcrossing have happened. Together they rule out whole categories of test before you spend a dollar.

One: a maternal marker can only ever name one parent

In most flowering plants, chloroplasts are inherited from the mother: a tree's chloroplasts came from the ovule, not the pollen. Burgess and colleagues used this to read the maternal lineage of each hybrid from mulberry chloroplast DNA.1 It makes chloroplast DNA an excellent species marker and a limited hybrid marker.

If white mulberry pollen fertilises a red mulberry flower, the seedling is a 50/50 nuclear hybrid with a pure red mulberry chloroplast. Any chloroplast test will call that tree red mulberry. That describes about a third of the hybrids Burgess found, with a 95% interval from 17% to 52%; the interval is wide because the result rests on 25 sequenced trees, and its 68:32 split could not be distinguished from an even one.1 computed here A better chloroplast assay cannot recover those trees, because the information is not in the molecule.

A chloroplast test works well in the other direction. A tree that looks like red mulberry but has a white mulberry chloroplast is not pure, and one PCR shows it. (PCR, the polymerase chain reaction, is a routine lab method that makes millions of copies of a target stretch of DNA; here, the stretch that differs between red and white mulberry.) Most of the hybrids Burgess sequenced had a white-type chloroplast, so this catches most of them, but the small sample cannot say how many it misses.

Two: detection decays by half with every backcross

Closing the maternal blind spot needs a marker inherited from both parents. A biparental marker has its own limit, and that limit comes from arithmetic.

At a locus where the two species are fixed for different variants, a first-generation hybrid carries one copy of each. It is heterozygous and detectable with certainty at a single locus. Backcross that hybrid to white mulberry, and each offspring has a one-in-two chance of inheriting the red variant at that locus. Backcross again and the chance is one in four. With n independent fixed-difference markers, the chance that a first backcross looks pure is 0.5ⁿ.

The first column is the one people miss. In principle, a single biparental fixed difference detects every first-generation hybrid, because an F1 inherits one copy from each parent and must carry both variants. What one locus cannot do is see deep backcrosses. Ten markers catch first-generation hybrids and first backcrosses. Fifty make it unlikely that anything within three generations is missed. Thousands, which sequencing provides, let you estimate the ancestry fraction instead of answering yes or no.

Because real markers rarely meet the ideal assumptions, the practical guidance asks for many of them. A simulation study by Vähä and Primmer concluded that efficient detection of first-generation hybrids needs 12 to 24 markers, and that "separating backcrosses from purebred parental individuals requires a considerable genotyping effort (at least 48 loci), even when divergence between parental populations is high."6

The rest of this page judges each method on those two limits.

The published recordSearched through August 2026

What already exists, and why none is yet a validated panel

The obvious move is to find the published marker panel for this species pair and use it. I found several partial precedents and no finished one. Because "no panel exists" is easy to say and easy to get wrong, this file sets out what I checked.

The foundational study used markers that don't transfer between labs

Burgess and colleagues' 2005 paper is still the reference measurement for mulberry hybridisation, and it is the source of the 53.7% figure. The nuclear markers were RAPDs (randomly amplified polymorphic DNA), read alongside chloroplast sequence.1 RAPDs are dominant, so a heterozygote looks the same as a homozygote for the present allele. They are also anonymous, meaning the bands are not tied to known sequence, and they are sensitive to reaction conditions, so results generally do not transfer between laboratories. The study stands as a published measurement. The paper gives its five primers and reaction conditions, but for the same reproducibility reason it is not a protocol you can pick up and rely on.

Its numbers set the resolution of the best measurement available. They screened 100 RAPD primers and kept five. Those yielded nine species-diagnostic fragments (five for white mulberry, four for red) plus 34 that were polymorphic but not diagnostic, for 43 scored in total.1 The hybrid classifications came from a maximum-likelihood index built on all 43 fragments, not the nine alone. Because these are dominant, anonymous markers never tested on known crosses, their sensitivity does not follow from the ideal single-locus arithmetic in File 04. The reference sets were cleanly separated: the red set averaged 0.89 on the index (95% interval 0.79–0.93) and the white 0.09 (0.05–0.20). The means fall short of 1 and 0 because most fragments are polymorphic rather than fixed, and the index is a probability.1

The microsatellite work exists, and was not designed for this question

There are two relevant efforts. Nepal's 2008 dissertation ran both microsatellites and RAPDs on a Kansas population. This is the analysis behind File 03, where ten trees field-assigned to a parental species landed in the intermediate-ancestry range.10 The more recent one is Schreier and Nepal's survey of 78 trees across six Upper Midwest populations, posted to bioRxiv in July 2026 and not yet peer reviewed.20 preprint They screened 12 markers originally developed in Asian Morus: M. indica (which their paper treats as synonymous with M. alba, although Kew currently accepts it as distinct) and M. boninensis. Five amplified cleanly in M. rubra and were used for the analysis.

The limitation is narrower, and the authors state it themselves. The study was designed as an M. rubra population survey, and its limitations section names "the absence of reference M. alba and confirmed hybrid genotypes," concluding that "additional highly informative nuclear markers are therefore needed to resolve the extent, directionality, and demographic consequences of introgression."20 Whether those five loci are ancestry-informative is therefore unmeasured, because the design could not measure it.

Where individuals showed extra allelic peaks, the pattern that looks most like introgression, the authors decline to call it: such profiles "do not independently demonstrate allopolyploidy or introgression from M. alba," and what is needed is "species-diagnostic nuclear SNPs or genome-scale data."20

There is one possible risk. Observed heterozygosity was below expected at every locus in every population (a mean of 0.34 against 0.65), and the authors list null alleles and allele dropout among the possible causes.20 If a primer silently fails on one species' allele, a heterozygous hybrid can read as a homozygous pure tree. A heterozygote deficit does not establish this on its own: inbreeding, population subdivision (the Wahlund effect) and sampling structure produce the same signature, and the authors name those too. The dataset contained no confirmed hybrids, so nothing in it shows dropout turning hybrids into pure calls. It is a failure mode to test for with known crosses, not an observed outcome.

The older result is more telling. Nepal's two analyses agreed on only eight candidate hybrids — eight of 18 from microsatellites, eight of 17 from RAPDs.10 The classifications depended heavily on the marker set. Because neither panel was validated against known parents and hybrids, the study cannot say which list was more accurate, or how reliable either is.

Two operational efforts, neither publicly specified

Canada runs the most extensive red mulberry identification programme. Leaf samples go to the University of Guelph Arboretum for genetic testing to call each tree red, white or hybrid, and the recovery strategy designates critical habitat only for trees "confirmed as pure-strain Red Mulberry trees through genetic testing."13 The programme excludes trees from surveys on the strength of its calls.12 But neither the recovery strategy nor the Arboretum's published material names the markers, the loci or the technique. not disclosed in any source I could find

Separately, a US SARE-funded citizen-science project, Red Mulberry Search and Rescue, collected over 100 leaf samples nationally. It had DNA extracted at the Ohio University Genomics Facility and worked with Los Alamos National Laboratory to begin building an M. rubra genome to compare samples against the existing M. alba one.21 It reports classifying samples as rubra, alba or hybrid "with a high degree of accuracy", and states the limitation itself: because no complete rubra genome existed, "the results are not necessarily indicative of complete purity of species."21 This is a genome-comparison approach rather than a marker panel, and its classifier is not published in a form anyone can rerun.

Neither of these is a criticism. A conservation programme has no obligation to publish a protocol, and a farmer-grant project has no obligation to release a classifier. It does mean a third party cannot pick up either of the two most-used methods for this question.

A 2024 set of single-copy nuclear genes adds another source of candidates.23 File 08 tests it against public reads from more trees and derives three candidate digests from it. They are candidates, not a validated panel.

The most useful thing to look for, then, is a fixed difference: a position where every red mulberry carries one variant and every white mulberry another, tied to known sequence so anyone can check it, and readable without specialist equipment. The rest of this page derives two, one maternal and one biparental. Neither has been validated against known crosses either, and the page flags that where it matters.

Brookings, South Dakota45 chloroplast genomes · eight states · 2025

Where the two genomes differ

Finding a fixed difference used to mean a sequencing project. Enough Morus sequence is now public that the marker can be found from existing data, and anyone can repeat the analysis.

In 2025 a group at South Dakota State University published complete chloroplast genomes for 45 mulberry trees collected across eight US states, deposited as GenBank accessions PQ309062–PQ309106.3 That dataset shows directly which stretch of DNA to use.

I downloaded all 45 and analysed them. computed here

Aligning a red mulberry genome (159,423 bp) against a white mulberry one (159,293 bp) gives 421 single-base differences and 696 insertion or deletion events. The largest indel is 36 bp, and most of the ten largest are tandem-repeat expansions (a short motif repeated one extra time). Repeats like these expand and contract on their own and are prone to assembly error, so they make unreliable species markers.

So there is no large, clean length difference that would show up by running a PCR product straight onto a gel. The dependable signal is in substitutions, which have to be either sequenced or cut with an enzyme.

Which region carries the signal

For each candidate region I counted positions where all 33 unambiguous red mulberries were fixed for one base and all 10 unambiguous white mulberries fixed for another.

Two results stand out. First, the standard plant barcodes work: rbcL and matK carry five and four fixed differences. That is unusual for two species in the same genus, so a conventional barcoding workflow can be used here. With only four or five informative positions, though, one sequencing error costs you a quarter of your evidence.

Burgess used one of these. Their chloroplast work sequenced an 802 bp window of rbcL and found the two species differing at three fixed sites, with no variation within either species.1 Three sites across 42 trees was enough to call maternal lineage, and it is consistent with the five this analysis finds across the whole gene. rbcL works, but rpl32–trnL carries roughly forty times more signal, which is enough to read with a restriction digest instead of a sequencing run.

Second, rpl32–trnL(UAG) is far ahead at 131 fixed differences. It separated all 43 unambiguous trees: every red mulberry scored 131 out of 131 red-type positions, and every white mulberry 131 out of 131 white-type, with no intermediates.

Two limits apply. “Unambiguous” means the 43 of the 45 whose plastome agrees with their GenBank label. The discordant remainder, labelled one species but carrying the other's plastome, is set aside and discussed in File 07, so the clean separation of all 43 applies only to the accessions that were kept. And the trees come from eight states, not the whole range, so the 131 positions are fixed in the genomes sampled here. They are strong candidate diagnostics, not differences proven fixed across either species everywhere.

NCBI, Bethesda, MarylandRefSeq NC_070233

The marker that wasn't, and the reference that misleads

A perfect 69 bp marker, which does not exist

Early in the analysis a different region looked ideal. The spacer between rps15 and ycf1 came out at 333 bp in every white mulberry and 405–407 bp in every red mulberry: a 70 bp gap, easy to read on a gel with no enzyme.

The difference is an annotation artifact. The ycf1 gene is annotated as starting 69 bp further along in the white mulberry records than in the red mulberry ones, so the same DNA falls inside the gene in one set of records and inside the spacer in the other. Comparing "spacer lengths" compares two different things. Searching all 199 Morus chloroplast genomes in GenBank for the supposedly red-mulberry-specific 69 bp block found it in every one, including all 101 white mulberries. computed here

This mistake is easy to make and hard to see. Check any length difference derived from annotation coordinates against the sequence itself.

The NCBI red mulberry reference carries a white-type plastome

Scored against the diagnostic positions it comes out 12 white-type to 2 red-type. Its length, 159,289 bp, matches white mulberry (159,293 bp), not the red mulberry range of 159,396–159,423 bp. GenBank records it as identical to accession OP161259.4 The authors of the 2025 study also noticed that this accession falls among the Asian species in their phylogeny.3 computed here

This does not show that the source tree was misidentified. As File 04 explains, a plastome reports maternal lineage, not nuclear ancestry. The source could be a largely M. rubra tree that carries a white mulberry chloroplast through introgression, which is common: most of the hybrids Burgess sequenced carried the white type. What can be said is that the record is taxonomically discordant.

Either way, anyone comparing a sample against "the M. rubra reference genome" is comparing it against a white mulberry–type plastome and will get the wrong answer. Use the vouchered PQ309073–PQ309106 series instead.

The same check found the reverse case. Accession PQ309072, deposited as M. alba, carries a plastome that is red-type at 131 of 131 positions: a tree identified as white mulberry whose maternal line was red. computed here This is the two-way introgression Burgess described, turning up by chance in a modern dataset, and it shows clearly that a plastome names a maternal lineage, not a species.

A Kew "red mulberry" from Bermuda

Kew's Plant and Fungal Trees of Life project sequenced a herbarium specimen filed as M. rubra: K000214340, collected by M. A. Hamilton (MH 618) in Hamilton Parish, Bermuda, on 24 February 2007. Bermuda is outside the native range of red mulberry, and the label's "Det by" line is blank. The reads are on NCBI as ERR4009368, still under the name Morus rubra.

Unlike NC_070233, this one is not a chloroplast-only mismatch. Scored with the methods in File 08, it reads as white mulberry in every part of the genome I could check. In the nuclear genes it carries the white base at 779 of 913 called positions, the same rate as confirmed white trees. Its ITS reads are 73% white-type, where three independent red trees showed none. Its chloroplast reads are mostly white-type. computed here

Kew reached the same answer. Its Tree of Life release files renamed the sample Morus alba from release 3.0 and dropped it from release 4.0, and Zuntini et al. 2024 cite the specimen as M. alba.2726 published Kew's herbarium catalogue and the NCBI record still say M. rubra. The same reads were used in a 2021 phylogenomic study of the mulberry tribe.25 The data cannot say whether the plant was misidentified or the DNA came from a different sample.

University of Central MissouriHybrid specimen KANU:361918 · 2010

One PCR, one enzyme, one gel

The 131 fixed differences in rpl32–trnL(UAG) can be read by sequencing. They can also be read for a few dollars with a restriction enzyme, because some of those differences create or destroy an enzyme's recognition site.

I searched the amplicon (the stretch of DNA the PCR copies) for enzymes whose number of cuts differs consistently between the species, then computed the predicted fragments for all 43 unambiguous trees. One enzyme works especially well.

HpyCH4III

Across those 43 trees, red mulberry carries one cut site in the amplicon and white mulberry carries three. computed here The two patterns look different at a glance, so you do not need to measure band sizes carefully.

Red mulberry gives one heavy band high on the gel. White mulberry gives a band slightly below it plus an obvious small band near the bottom. A hybrid shows the pattern of its maternal line, so the test reports maternal chloroplast lineage and nothing else.

If HpyCH4III is hard to source, HinfI (cheaper, more widely stocked) separates the two with a busier pattern: red mulberry shows bands near 228 and 168 bp where white shows a single ~425 bp band. SspI and BfaI also work. computed here

The second assay: a biparental marker

The chloroplast assay has the first limit from File 04: it cannot see the third of hybrids that carry a red-type chloroplast. Closing that gap needs a locus inherited from both parents, and there is one you can run in the same afternoon from the same DNA extraction.

ITS sits in the nuclear genome, so a tree inherits it from both parents. If the two species carry different ITS variants, a hybrid carries both, and both show on a gel. This is the codominant signal that the arithmetic in File 04 calls for. A first-generation hybrid must carry both variants, so in principle this one locus flags all of them, subject to the multicopy caveat in File 04.

I downloaded every full-length Morus ITS sequence from GenBank (90 labelled M. rubra and 90 labelled M. alba) and aligned them. computed here The species differ at 22 near-fixed positions, and one of them creates a restriction site.

The amplicon uses the universal ITS1 and ITS4 primers published by White and colleagues in 1990,16 which are among the most widely used ITS primers across plants and fungi, and match the Morus sequences. verified against the sequences The enzyme is NEB MboI, R0147S, 500 units for $88.00. confirmed

ITS1  TCCGTAGGTGAACCTGCGG
ITS4  TCCTCCGCTTATTGATATGC

Both parental variants have been recovered from a real hybrid

A prediction alone is weak evidence. A group at the University of Central Missouri ran a relevant experiment in 2010, and the data are in GenBank. They support the prediction, with one limit set out below.

They took a herbarium-vouchered M. alba × M. rubra hybrid — specimen KANU:361918 — cloned its ITS, and sequenced four clones from that one tree.17 I downloaded all four and scored them at my diagnostic site. computed here

I scored their pure reference trees too: all eight red mulberry clones carry one MboI site, and all three white mulberry clones carry two. computed here

A second variant at the same locus, from a published study

While checking this, I found a second polymorphism at the same locus. A 2025 paper in Plants genotyped 542 mulberry accessions across the ribosomal region, recovering 158 SNPs and 15 indels, and built a CAPS marker (a PCR-and-enzyme test like the ones here) on a 13 bp insertion in ITS1.18 In my downloaded set that insertion is present in red mulberry and absent in white. It creates an MstI site. FspI is an isoschizomer that recognises the same TGCGCA sequence and is more commonly stocked, so order that one.

That paper supports less than it might seem to. Its CAPS assay was built to separate M. alba and M. notabilis from other Morus species, a taxonomic question, using BstEII and MstI. It was not a red-versus-white hybrid test, it did not use FspI, and it did not measure whether the assay detects mixed parental repeat classes in an F1 or a backcross.18 It does show that the locus carries scoreable variation and that a restriction assay on it works at the bench.

Scored against my downloaded set, the insertion is present in 88 of 88 clean red mulberry sequences and 1 of 90 white mulberry. computed here The ITS region therefore carries two diagnostic variants, at different positions, each readable with its own enzyme.

That paper also publishes mulberry-specific ITS primers. If you are ordering new primers, use those instead of the universal ones.

The GenBank check also turned up the same labelling problem as the chloroplast data. Two of the 90 sequences deposited as M. rubra carry pure white mulberry ITS at every diagnostic position. computed here They are OR251260 and FJ605516, the same two the literature search had already flagged.

A third marker: single-copy nuclear genes

Both ITS variants sit in one repeat array, so a second nuclear check has to come from a different part of the genome. Single-copy genes avoid the repeat problem as well: each tree carries exactly two copies, one from each parent.

Wang and colleagues published alignments of 211 single-copy nuclear genes from 14 Morus species in 2024, including one red mulberry and three white.23 In those alignments the red tree differs from all three white trees at 1,149 positions across 155 genes. computed here One red tree cannot tell a species difference from a variant private to that tree, so I tested every position against raw sequencing reads from more trees:

• Red mulberry: three trees independent of the original, from Florida and Illinois (Morton Arboretum vouchers) and Mississippi State University, plus the original tree's own raw reads.
• White mulberry: 15 trees, including Morton Arboretum's var. tatarica and var. pendula, one from Mississippi State, and ten resequenced genomes from a Chinese population study.

The 8 genes that hold sit on six different chromosomes of the white mulberry genome.24 computed here Twenty of the 38 positions create or destroy a common restriction site. Three of them give clean single-cut tests with primers that match the genome exactly once and match both species:

The protocol

1. Collect and dry

   Young, fully expanded sun leaves. Dry them immediately in silica gel at roughly ten times the tissue mass. This step matters more than any other: properly dried tissue yields good DNA for years at room temperature, and a leaf left in a warm bag overnight may yield none. Photograph the tree, the bark and both leaf surfaces, and take a GPS point.

2. Extract DNA

   A silica-column plant kit, or CTAB if you prefer to mix your own. Mulberry leaves are high in polysaccharides and phenolics, so add PVP to a CTAB prep or use a kit with an inhibitor-removal step. A generic animal-tissue kit usually gives poor results.

3. Amplify rpl32–trnL(UAG)

   Use the published universal primers from Shaw and colleagues.5 I checked both against the Morus sequences. computed here

   rpL32-F  CAGTTCCAAAAAAACGTACTTC
   One mismatch to Morus, which reads …CCG… where the primer has …CCA…. It sits at position 8, far from the 3′ end, and will amplify normally.

   trnL(UAG)  CTGCTTCCTAAGAGCAGCGT
   Exact match in both species.

   Expect roughly 1,800 bp. Run 5 µL on a gel to confirm a single clean product before digesting.

4. Amplify ITS as well

   Same DNA, second tube, primers ITS1 and ITS4. Expect roughly 700 bp. Running both loci from one extraction costs one extra tube and gives you the nuclear result alongside the maternal one.

5. Optional: the single-copy checks

   Same DNA, one more tube per locus, with the primers above. BamHI and DraI both cut at 37 °C, so they share the water bath. Use a 2% gel to see the smaller fragments.

6. Digest

   Take 10 µL of each product, add buffer and about 5 units of enzyme (HpyCH4III for the chloroplast amplicon, MboI for the ITS amplicon), and hold at 37 °C for an hour. Both enzymes work at the same temperature, so they can share a water bath. Unpurified product straight from the PCR usually digests well enough for a yes/no readout, but leftover PCR components can inhibit the enzyme. NEB recommends cleaning the product up first; if a digest looks incomplete, dilute or purify it and repeat.

7. Run and read

   Run a 1.5% agarose gel with a 100 bp ladder, a known white mulberry as a positive control, and a no-template (water) reaction to catch contamination. White mulberry is everywhere; take one from a hedgerow and confirm the assay works on it before you trust it on anything rare. Also run an uncut aliquot of each PCR product beside its digest, because a failed or partial digest can pass for a genotype. This matters most for the ITS assay: uncut ~700 bp product runs almost where a fully cut red mulberry band does, so an under-digested white or hybrid can read as pure red.

   Read the two lanes together. The chloroplast lane names the maternal chloroplast lineage. The ITS lane says whether both species are represented in the nuclear genome. Three bands in the ITS lane mean both parental types are present: the hybrid signal.

The benchPrices confirmed 2 August 2026

What the bench costs

You can buy both assays as a service (see the next file), so you don't need your own equipment. Owning it pays off if you expect to run many samples: the cost per tree falls to a few dollars and results take an afternoon instead of weeks. This section lists what it costs.

Twenty years ago this work needed a university facility. Now it needs four appliances and a shoebox of reagents. Nothing below requires a licence, an institution, or a laboratory address.

Before buying anything

Consider two cheaper routes first.

Community biology labs own all of this and let members run their own projects. Verified monthly rates: BosLab, Somerville MA — $50; SoundBio, Seattle — $55, or $135 to lead your own project; ChiTownBio, Chicago — $75; Counter Culture Labs, Oakland — $100; BUGSS, Baltimore — $100; Genspace, Brooklyn — $110 community, $220 for full project access. confirmed Most ask for a short project proposal and a safety session.

Counter Culture Labs suits this project best. It runs a standing plant biology group, and its fungal group already does ITS extraction and sequencing, which is the second assay on this page.

Or send the reading out. If you sequence the amplicon instead of digesting it, you read all 131 chloroplast positions instead of the few one enzyme sees. Psomagen charges $3.50 a reaction; Quintara from $4.00; Eurofins SimpleSeq prepaid kits work out at $6.10; Plasmidsaurus sequences an unpurified amplicon for $15 and takes a credit card with no minimum. confirmed Azenta/GENEWIZ confirms in its own FAQ that individuals can register and pay by card, though it publishes no price.

So the comparison is the thermocycler plus a few dollars a read, against the thermocycler plus the gel rig plus enzymes. At three to fifteen dollars a read, sequencing gives more information per tree and takes longer. It saves the $309 gel rig and the $171 of enzymes, not the whole $1,599.

Five routesFree to $1,000 a tree

What each method resolves

This table puts the methods side by side. Cost and resolution don't rise together: the cheapest useful step is nearly free, and most of the cost goes on the last bit of certainty.

The two gel assays answer a different question from sequencing; they aren't a cheaper version of it. The chloroplast assay rejects trees. The ITS assay targets the first-generation hybrid, and the single-copy digests check its answer at loci that fail in different ways. Neither can catch a tree several generations into backcrossing, with a red-type chloroplast, homogenised ITS, and a quarter of its genome still from white mulberry.

The table has no sensitivity figure for each row, and that gap matters most. Nobody has measured how often these assays miss a hybrid, because that needs known crosses, and (per File 05) nobody has assembled that reference set for this species pair. The "detects" column describes what each method is designed to reach, not a measured hit rate. See File 11 before attaching a confidence number to any of it.

For a deeply backcrossed tree, or if you need an ancestry estimate rather than a yes/no flag, use the last row.

When you need genome-wide ancestry: genome skimming

Send extracted DNA for low-coverage whole-genome sequencing. At one or two times coverage you recover the complete chloroplast genome as a byproduct, because it is present in thousands of copies per cell. You also get nuclear variants that can place the tree on a triangle plot of hybrid index against heterozygosity, which separates first-generation hybrids from backcrosses and from pure trees. Placing a tree confidently on that plot, especially on the heterozygosity axis, takes considerably more coverage than recovering the chloroplast.7 One experiment can answer both questions, with no wet-lab marker panel to build. It still needs genotypes called at many ancestry-informative sites for each tree, and a trustworthy set of pure-parent references to define those sites. As File 05 found, no validated reference set exists yet for this species pair.

Prices: Plasmidsaurus publishes $250 for 1 Gb, $500 for 5 Gb, $1,000 for 15 Gb, and lists plants among the organisms the service covers. confirmed The $250 tier is specified for genomes of 20–60 Mb. A 340 Mb mulberry genome falls in the 300–750 Mb band, which is the $1,000 tier. A gigabase against 340 Mb is about 3× coverage and would probably support a hybrid index, but it isn't the configuration they sell for a genome that size.

The hard part is getting the DNA. Plasmidsaurus does not accept any intact tissues or organs from animals, plants, insects, fungi, etc. confirmed A leaf in an envelope is refused. Plant material is taken only as protoplasts with the cell walls stripped, or as high-molecular-weight genomic DNA you extracted yourself — RNase-treated, and never touched by phenol or chloroform.

SeqCenter has the same requirement. It posts nanopore ligation prices openly: $150 for 300 Mb, $175 for 600 Mb, $225 for 1.2 Gb, library prep included confirmed. There is no quote request and no institutional account, and it is cheaper per gigabase than the tiers above. But it wants 60 µL at 40 ng/µL of clean double-stranded DNA, and its own extraction service covers only certain microbes.

So you can buy the sequencing cheaply from a web page. Turning a mulberry leaf into a tube of sequenceable DNA is the step that still needs a lab bench, or a core facility willing to do the extraction for you.

There is no red mulberry nuclear genome assembly. NCBI lists zero assemblies and six sequencing runs for the species, against four assemblies for white mulberry. computed here Nuclear reads therefore have to be mapped to the white mulberry reference, which works for ancestry estimation but introduces a mild bias and needs someone experienced to do it.

Two groups are working on this. Schreier and Nepal state in their preprint that low-coverage genome-skimming data already exist for the species and that development of a high-quality nuclear reference genome is underway using PacBio long-read and Hi-C scaffolding data, alongside complete chloroplast and mitochondrial genomes from which hundreds of candidate organellar markers are undergoing validation.20 preprint Separately, the SARE citizen-science project has been working with Los Alamos National Laboratory towards an M. rubra assembly for the same purpose.21 Anyone starting this work now should check whether either has landed before mapping to white mulberry.

A test that costs a few dollars and rules out most hybrids is still worth running: it turns a guess into a shortlist. Send the trees that pass for sequencing.

Any stand, seed lot or nursery batch1 − (1 − p)ⁿ

How many trees to test

The number of trees you test sets the cost of a screening programme. It depends on whether you are trying to find hybrids or to show there are none, and the second takes far more testing.

Suppose you are looking at a group that should be red mulberry — a stand, a seed lot, a batch of planting stock — and some unknown fraction p of it is admixed. If you test n individuals, the chance of catching at least one hybrid is 1 − (1 − p)ⁿ.

The left-hand column is roughly what Burgess measured — 98 of 184 trees, in populations that had been sought out because they held red mulberry.1 Canada's recovery strategy repeats the same 53.7% figure for its core populations.13 That is almost certainly the same measurement, not an independent one, but it is the number the recovery programme plans around. At that rate, five tests find a hybrid 97 times in 100.

Two cautions on borrowing that number, both from the authors. The sampling took every putative red mulberry but only about a quarter of the surrounding white and hybrid trees, so they warn the figure "is an overestimate of the frequency of hybrids (and underestimate of whites)".1 Pulling the other way, it counts only hybrids that survived to be sampled — "hybridization rates for Morus may be even higher at the time of fertilization."1 So treat 50% as a working figure for a stand where both species grow together. It is not a measured constant, and it doesn't transfer to a stand you haven't sampled.

If all n come back clean, you have only an upper bound on the hybrid fraction, and it falls slowly as n grows.

So design the programme to reject trees. Test a handful from any group you suspect and act on the first positive. Save the expensive genome-wide methods for the few trees that pass screening and that you plan to collect seed from, protect, or propagate.

Report what the result supports. No method on this page can show that this stock is pure red mulberry. A supportable statement looks like this: mother tree chloroplast red-type, both ITS variants red-type, twenty offspring screened with no hybrids detected by an assay of unmeasured sensitivity — so the detectable hybrid fraction is under 14% at 95% confidence. That is a weaker claim, and it is what the evidence supports.

Your state natural heritage programAfter the result

What to do with a result

Voucher everything. A genetic result is only useful as evidence if it is tied to a GPS point, a set of photographs and a pressed specimen. You can deposit herbarium sheets with a regional herbarium; most welcome material from a documented wild population.

Consider sending samples onward. Madhav Nepal's group at South Dakota State University generated the 45-genome dataset this page is built on, works directly on red mulberry hybridisation,3 and has recently posted a population-genetic survey of 78 red mulberries across Kansas, Iowa, Wisconsin and Nebraska as a preprint.20 Their sampling is concentrated in the central US; the eastern and southeastern parts of the range look thin. Tissue from an unsampled population would fill a gap in their data.

If a population comes back clean, tell your state natural heritage program, whether or not red mulberry is formally listed where you are.

The words, in one place

Each term is defined where it first appears. They are collected here for reference.

References

1. Burgess, K. S., Morgan, M., Deverno, L. & Husband, B. C. (2005). Asymmetrical introgression between two Morus species (M. alba, M. rubra) that differ in abundance. Molecular Ecology 14: 3471–3483. pubmed.ncbi.nlm.nih.gov/16156816
2. Penskar, M. R. (2009). Special Plant Abstract for Morus rubra (red mulberry). Michigan Natural Features Inventory, Lansing, MI. mnfi.anr.msu.edu
3. Adhikari, B., Parajuli, S. & Nepal, M. P. (2025). Reporting complete chloroplast genome of endangered red mulberry, useful for understanding hybridization and phylogenetic relationships. Scientific Reports. GenBank PQ309062–PQ309106. pmc.ncbi.nlm.nih.gov/articles/PMC12008415
4. Zeng, Q., Chen, M., Wang, S., Xu, X., Li, T., Xiang, Z. & He, N. (2022). Comparative and phylogenetic analyses of the chloroplast genome. Frontiers in Plant Science 13: 1047592. Source of accession OP161259, from which RefSeq NC_070233 is derived. ncbi.nlm.nih.gov/nuccore/NC_070233
5. Shaw, J., Lickey, E. B., Schilling, E. E. & Small, R. L. (2007). Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany 94: 275–288. Source of the rpL32-F and trnL(UAG) primers. doi.org/10.3732/ajb.94.3.275
6. Vähä, J.-P. & Primmer, C. R. (2006). Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Molecular Ecology 15: 63–72. pubmed.ncbi.nlm.nih.gov/16367830
7. Wiens, B. J. & Colella, J. P. (2025). triangulaR: an R package for identifying AIMs and building triangle plots using SNP data from hybrid zones. Heredity. nature.com/articles/s41437-025-00760-2
8. Wunderlin, R. P. (1997). Moraceae: Morus. In Flora of North America North of Mexico, vol. 3. Oxford University Press. efloras.org — genus key, M. rubra, M. alba
9. Nepal, M. P., Mayfield, M. H. & Ferguson, C. J. (2012). Identification of eastern North American Morus: taxonomic status of M. murrayana. Phytoneuron 2012-26: 1–6. The clearest published character comparison, and the source of the statement that fruit colour is non-diagnostic. phytoneuron.net (PDF)
10. Nepal, M. P. (2008). Systematics and reproductive biology of the genus Morus L. (Moraceae). PhD dissertation (not peer-reviewed), Kansas State University. Source of the Konza Prairie comparison of field morphology with RAPD and microsatellite classifications. krex.k-state.edu
11. Burgess, K. S. (2004). The genetic and demographic consequences of hybridization in small plant populations. PhD thesis, University of Guelph. The fuller analysis behind Burgess et al. 2005; listed for further reading. atrium.lib.uoguelph.ca
12. COSEWIC (2014). Assessment and Status Report on the Red Mulberry Morus rubra in Canada. Listed under COSEWIC assessments on the species page. Species at Risk Public Registry — Red Mulberry
13. Parks Canada Agency (2013). Recovery Strategy for the Red Mulberry (Morus rubra) in Canada. Species at Risk Act Recovery Strategy Series. Listed under Recovery strategies on the same species page. Species at Risk Public Registry — Red Mulberry
14. New England Biolabs product catalogue, prices confirmed 2 August 2026: HpyCH4III R0618S, HinfI R0155S, OneTaq 2X Master Mix M0482S, 100 bp DNA Ladder N3231S
15. miniPCR bio (Amplyus LLC) store, prices confirmed 2 August 2026. minipcr.com/store
16. White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications, pp. 315–322. Academic Press. The source of the ITS1 and ITS4 primers, now used across plants as well as fungi. doi.org/10.1016/B978-0-12-372180-8.50042-1
17. Nikaido, S., Salah, S. M., Ely, J. S., Wolf, H. J. & Raveill, J. A. (2010). Mulberry (Morus: Moraceae) hybridization in eastern North America: morphological and molecular evidence. University of Central Missouri. Unpublished; data deposited as GenBank HQ144170–HQ144187, including four cloned ITS sequences from the vouchered hybrid KANU:361918. ncbi.nlm.nih.gov/nuccore/HQ144170
18. Xu, X., Zhang, L., Bi, C., Qin, M., Wang, S., Li, D., He, N. & Zeng, Q. (2025). Extensive nrDNA polymorphism in Morus L. and its application. Plants 14(16): 2570, published 18 August 2025. Open access. 158 SNPs and 15 indels across 542 accessions. Source of the 13 bp ITS1 indel and of the evidence that concerted evolution in Morus is incomplete. Its CAPS assay uses BstEII and MstI and was built to separate M. alba and M. notabilis from other Morus species — a taxonomic discrimination, not a red–white hybrid test. doi.org/10.3390/plants14162570
19. Xuan, Y., Wu, Y., Li, P., Liu, R., Luo, Y., Yuan, J., Xiang, Z. & He, N. (2019). Molecular phylogeny of mulberries reconstructed from ITS and two cpDNA sequences. PeerJ 7: e8158. doi.org/10.7717/peerj.8158
20. Schreier, S. J. & Nepal, M. P. (2026). Population genetics of native red mulberry at its northwestern boundary suggests postglacial founder effects. bioRxiv preprint, posted 14 July 2026, not certified by peer review. 78 M. rubra individuals across six populations in Kansas, Iowa, Wisconsin and Nebraska. doi.org/10.64898/2026.07.11.737963
21. Cornett, J. (2022–2024). Red Mulberry Search and Rescue: preserving genetic diversity for the future of sustainable agroforestry. USDA SARE Farmer/Rancher grant FNC22-1338. Citizen-collected leaf samples, extraction at the Ohio University Genomics Facility, genome comparison against M. alba with Los Alamos National Laboratory. Reports rubra / alba / hybrid calls but states the results are "not necessarily indicative of complete purity of species." projects.sare.org/sare_project/fnc22-1338
22. Weakley, A. S. & the Southeastern Flora Team (2026). Flora of the Southeastern United States. University of North Carolina Herbarium (NCU), North Carolina Botanical Garden. The only source found that records the petiole cross-section contrast: M. alba "petioles with shallow groove on upper side", M. rubra "petioles terete or slightly flattened on upper side". fsus.ncbg.unc.edu
23. Wang, M., Zhu, M., Qian, J., Yang, Z., Shang, F., Egan, A. N., Li, P. & Liu, L. (2024). Phylogenomics of mulberries (Morus, Moraceae) inferred from plastomes and single copy nuclear genes. Molecular Phylogenetics and Evolution 197: 108093. Data: Dryad, alignments of 211 single-copy nuclear genes from 30 samples. pubmed.ncbi.nlm.nih.gov/38740145 · doi.org/10.5061/dryad.rjdfn2zj5
24. Chinese Academy of Sciences (2026). Morus alba var. multicaulis isolate Yrs300, haplotype A genome assembly MaHapA, GenBank GCA_060825015.1: 14 chromosomes, 327 Mb. Used to place the nuclear genes and design primers. ncbi.nlm.nih.gov/datasets/genome/GCA_060825015.1
25. Gardner, E. M. et al. (2021). Repeated parallel losses of inflexed stamens in Moraceae: phylogenomics and generic revision of the tribe Moreae and the reinstatement of the tribe Olmedieae (Moraceae). Taxon 70: 946–988. Source study (ENA PRJEB37667) for the Kew reads ERR4009368. biorxiv.org/content/10.1101/2020.04.08.030452v2
26. Zuntini, A. R. et al. (2024). Phylogenomics and the rise of the angiosperms. Nature. Its specimen list cites Hamilton 618 (K000214340) as Morus alba. nature.com/articles/s41586-024-07324-0 · GBIF 4527472734
27. Royal Botanic Gardens, Kew (2026). Kew Tree of Life Explorer, release 4.0 data files: revised_specimen_nomenclature.txt (ERR4009368, Morus rubra → Morus alba from release 3.0) and deleted_sequences.txt (ERR4009368 removed in release 4.0). Specimen: Kew Herbarium K000214340, images also on GBIF 925147023. sftp.kew.org/pub/paftol/current_release